|
Left Crispr |
Right Crispr |
| Crispr ID |
1123718302 |
1123718305 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:23044869-23044891
|
15:23044886-23044908
|
| Sequence |
CCTGGCCAGAGGTGCCGGGGGAC |
GGGGACAACATAACCACACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 11, 2: 24, 3: 147, 4: 275} |
{0: 1, 1: 10, 2: 54, 3: 60, 4: 160} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|