ID: 1123718954_1123718956 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1123718954 | 1123718956 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:23047156-23047178 | 15:23047173-23047195 |
| Sequence | CCTGGCCAGAGGTGCTGGGGGGT | GGGGGTATCATAATCTGACCTGG |
| Strand | - | + |
| Off-target summary | {0: 15, 1: 50, 2: 116, 3: 85, 4: 394} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||