ID: 1123721389_1123721401

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1123721389 1123721401
Species Human (GRCh38) Human (GRCh38)
Location 15:23064637-23064659 15:23064690-23064712
Sequence CCCCCATTGGAGTGTTGGGGGTC TCCGGCAAATTCCTAAATCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!