ID: 1123732227_1123732239

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1123732227 1123732239
Species Human (GRCh38) Human (GRCh38)
Location 15:23157139-23157161 15:23157168-23157190
Sequence CCCTGCCCCTCTCCCAGAGTTGG CTCCCCTCTCTTAGAGTGGGTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 12, 3: 57, 4: 439} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!