ID: 1123750366_1123750374

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1123750366 1123750374
Species Human (GRCh38) Human (GRCh38)
Location 15:23354526-23354548 15:23354550-23354572
Sequence CCCCTCTCCCAGAGTTGGCGGCC CTCCCCTCTCTTAGAGTGGGTGG
Strand - +
Off-target summary No data {0: 12, 1: 5, 2: 6, 3: 36, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!