ID: 1123750478_1123750485

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1123750478 1123750485
Species Human (GRCh38) Human (GRCh38)
Location 15:23355050-23355072 15:23355078-23355100
Sequence CCCACCCCTTCAGCAAGCAGCCC CTGCCCTCACCAATCACCCCAGG
Strand - +
Off-target summary {0: 21, 1: 10, 2: 6, 3: 38, 4: 321} {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!