|
Left Crispr |
Right Crispr |
Crispr ID |
1123750479 |
1123750485 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:23355051-23355073
|
15:23355078-23355100
|
Sequence |
CCACCCCTTCAGCAAGCAGCCCA |
CTGCCCTCACCAATCACCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 25, 1: 7, 2: 4, 3: 36, 4: 273} |
{0: 7, 1: 4, 2: 42, 3: 30, 4: 297} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|