ID: 1123765844_1123765855

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1123765844 1123765855
Species Human (GRCh38) Human (GRCh38)
Location 15:23477806-23477828 15:23477839-23477861
Sequence CCTGCAACAGCTTTGTTGCCCAG TTGAGAAGGGGTGAGGGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 117, 4: 1025}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!