ID: 1123787978_1123787983

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1123787978 1123787983
Species Human (GRCh38) Human (GRCh38)
Location 15:23691230-23691252 15:23691267-23691289
Sequence CCTGGGGATACAATGAGAAGTGA TCTGTACTGAGGGAAAGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!