ID: 1123833681_1123833684

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1123833681 1123833684
Species Human (GRCh38) Human (GRCh38)
Location 15:24167113-24167135 15:24167142-24167164
Sequence CCCCTTCTATTTTTTCTATATGC TGTATATTTCTTGTTTTTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 61, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!