ID: 1123840418_1123840425

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1123840418 1123840425
Species Human (GRCh38) Human (GRCh38)
Location 15:24242131-24242153 15:24242177-24242199
Sequence CCGCCCAGGTCACAGTAGCCCCT CGGTATTTTTTGTTTTTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 51, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!