ID: 1123849957_1123849961

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1123849957 1123849961
Species Human (GRCh38) Human (GRCh38)
Location 15:24344307-24344329 15:24344332-24344354
Sequence CCACTTTTAATTACATGCAAATT GGGGCAGTCAATGCAAATTGAGG
Strand - +
Off-target summary {0: 61, 1: 176, 2: 260, 3: 217, 4: 542} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!