ID: 1123870927_1123870933

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1123870927 1123870933
Species Human (GRCh38) Human (GRCh38)
Location 15:24571846-24571868 15:24571881-24571903
Sequence CCACTTTTAATTATATGCAAATT AATGCAAATTGAGGCAGGAAAGG
Strand - +
Off-target summary {0: 59, 1: 175, 2: 188, 3: 281, 4: 719} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!