|
Left Crispr |
Right Crispr |
Crispr ID |
1123904138 |
1123904142 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:24905334-24905356
|
15:24905351-24905373
|
Sequence |
CCCTGTCTCTACTAAATATACAA |
ATACAAAAATTAACTGGGCATGG |
Strand |
- |
+ |
Off-target summary |
{0: 482, 1: 65216, 2: 161992, 3: 186495, 4: 117003} |
{0: 698, 1: 24616, 2: 55042, 3: 97835, 4: 114860} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|