ID: 1123904139_1123904143

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1123904139 1123904143
Species Human (GRCh38) Human (GRCh38)
Location 15:24905335-24905357 15:24905354-24905376
Sequence CCTGTCTCTACTAAATATACAAA CAAAAATTAACTGGGCATGGTGG
Strand - +
Off-target summary {0: 1327, 1: 168386, 2: 211929, 3: 125950, 4: 67493} {0: 680, 1: 25225, 2: 71189, 3: 139880, 4: 182213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!