ID: 1123908499_1123908503

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1123908499 1123908503
Species Human (GRCh38) Human (GRCh38)
Location 15:24943654-24943676 15:24943681-24943703
Sequence CCAACAGCTGTTTCTCAAAAGGA AGTTAACTACAGAGGATAGCAGG
Strand - +
Off-target summary {0: 2, 1: 26, 2: 255, 3: 284, 4: 475} {0: 1, 1: 1, 2: 3, 3: 31, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!