ID: 1123909335_1123909338

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1123909335 1123909338
Species Human (GRCh38) Human (GRCh38)
Location 15:24951156-24951178 15:24951182-24951204
Sequence CCTGGCCGTTTTCATTTCTTTGT CTGCTTAGGAGTAGAATTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 900} {0: 1, 1: 0, 2: 12, 3: 118, 4: 755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!