|
Left Crispr |
Right Crispr |
| Crispr ID |
1123911444 |
1123911451 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:24971995-24972017
|
15:24972026-24972048
|
| Sequence |
CCTGTAATCCTAGCACTTGGGGA |
CCGGCAGGTCACCTGAAGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 149, 1: 24201, 2: 317814, 3: 257441, 4: 148888} |
{0: 2, 1: 29, 2: 1273, 3: 19008, 4: 52200} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|