ID: 1123922243_1123922250

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1123922243 1123922250
Species Human (GRCh38) Human (GRCh38)
Location 15:25078537-25078559 15:25078578-25078600
Sequence CCTGCAGCTCTCCCCATTGAAAT TTCTCTGATGGCCAAGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!