ID: 1123934944_1123934953

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1123934944 1123934953
Species Human (GRCh38) Human (GRCh38)
Location 15:25189582-25189604 15:25189634-25189656
Sequence CCTGAAGGACACCTTCGGGGTGC GCAGCCAAGGCTCCTTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!