ID: 1123960572_1123960575

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1123960572 1123960575
Species Human (GRCh38) Human (GRCh38)
Location 15:25395367-25395389 15:25395413-25395435
Sequence CCTGGGAAACAATTTCTTTCTTT CAGAGTAAACAGAAGTATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 99, 4: 911} {0: 1, 1: 0, 2: 3, 3: 43, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!