ID: 1124013567_1124013571

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124013567 1124013571
Species Human (GRCh38) Human (GRCh38)
Location 15:25858963-25858985 15:25858977-25858999
Sequence CCAGCAGCACCCTTGCAAGGCAC GCAAGGCACACTCCATTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 190} {0: 1, 1: 0, 2: 2, 3: 15, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!