ID: 1124014215_1124014228

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1124014215 1124014228
Species Human (GRCh38) Human (GRCh38)
Location 15:25862592-25862614 15:25862640-25862662
Sequence CCGGGGCGCCCTGCCCTGCGCCA CAACTCACCTGCTGAAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 401} {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!