ID: 1124014219_1124014230

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124014219 1124014230
Species Human (GRCh38) Human (GRCh38)
Location 15:25862606-25862628 15:25862649-25862671
Sequence CCTGCGCCACCGCGCGCTCGCTC TGCTGAAGACCAGGCAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199} {0: 1, 1: 0, 2: 2, 3: 30, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!