ID: 1124014220_1124014228

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1124014220 1124014228
Species Human (GRCh38) Human (GRCh38)
Location 15:25862612-25862634 15:25862640-25862662
Sequence CCACCGCGCGCTCGCTCGCCCGC CAACTCACCTGCTGAAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 56, 4: 421} {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!