ID: 1124014222_1124014239

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1124014222 1124014239
Species Human (GRCh38) Human (GRCh38)
Location 15:25862630-25862652 15:25862679-25862701
Sequence CCCGCCCGCCCAACTCACCTGCT TCTTGTGGTCGGAGCGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 289} {0: 1, 1: 0, 2: 0, 3: 2, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!