ID: 1124014225_1124014236

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1124014225 1124014236
Species Human (GRCh38) Human (GRCh38)
Location 15:25862635-25862657 15:25862668-25862690
Sequence CCGCCCAACTCACCTGCTGAAGA CAGGTGGTTGATCTTGTGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 302} {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!