ID: 1124040680_1124040684

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1124040680 1124040684
Species Human (GRCh38) Human (GRCh38)
Location 15:26100065-26100087 15:26100106-26100128
Sequence CCCTCAATTGGTATTTGACTGAT CTGGATTTATGTGTTTTTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 61, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!