ID: 1124042534_1124042545

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1124042534 1124042545
Species Human (GRCh38) Human (GRCh38)
Location 15:26118541-26118563 15:26118577-26118599
Sequence CCAGCCCTGGGGTGATGTGGGAA CCAGTGTGAGAGTCCAGTCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!