ID: 1124047253_1124047257

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1124047253 1124047257
Species Human (GRCh38) Human (GRCh38)
Location 15:26161710-26161732 15:26161731-26161753
Sequence CCTTCCTCCTGCTGGTACTGCTG TGGCATGAGCTGCAAAGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 24, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!