ID: 1124048676_1124048683

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124048676 1124048683
Species Human (GRCh38) Human (GRCh38)
Location 15:26175265-26175287 15:26175300-26175322
Sequence CCGGCCTAGAACTTGTAATGCAA CTGTGGGGATAGTTCCAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!