ID: 1124086328_1124086333

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1124086328 1124086333
Species Human (GRCh38) Human (GRCh38)
Location 15:26553745-26553767 15:26553778-26553800
Sequence CCCTGTCCTTAGTCAGGAGCACA AAGAAGGTCCTCACCCTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175} {0: 1, 1: 0, 2: 0, 3: 24, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!