ID: 1124090837_1124090846

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1124090837 1124090846
Species Human (GRCh38) Human (GRCh38)
Location 15:26598673-26598695 15:26598721-26598743
Sequence CCATTTTCCAAGCATTTGGAAAG TCACCTCACAAAGAACATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 279} {0: 1, 1: 0, 2: 2, 3: 15, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!