ID: 1124092996_1124093007

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1124092996 1124093007
Species Human (GRCh38) Human (GRCh38)
Location 15:26623833-26623855 15:26623863-26623885
Sequence CCCTCTGCTGCCTGACCCACCCT CCTGAGCAGCCCCCATGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 75, 4: 542} {0: 1, 1: 0, 2: 0, 3: 33, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!