ID: 1124098106_1124098107

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1124098106 1124098107
Species Human (GRCh38) Human (GRCh38)
Location 15:26668070-26668092 15:26668095-26668117
Sequence CCAGACAAGAGTCAGAGTCTCAG TTGCTACTTCCTTATAATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 177} {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!