ID: 1124108555_1124108562

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1124108555 1124108562
Species Human (GRCh38) Human (GRCh38)
Location 15:26764723-26764745 15:26764773-26764795
Sequence CCCAGAAGTAAGTTGCACCAGAA GCTCCACGGCACTGCTGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107} {0: 1, 1: 0, 2: 1, 3: 12, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!