ID: 1124111161_1124111168

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1124111161 1124111168
Species Human (GRCh38) Human (GRCh38)
Location 15:26789946-26789968 15:26789977-26789999
Sequence CCTTCCTCCAGCTGTTAAGACGG TTTTTTTTTTTTTCTTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98} {0: 1, 1: 68, 2: 1879, 3: 18149, 4: 136569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!