ID: 1124124788_1124124797

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1124124788 1124124797
Species Human (GRCh38) Human (GRCh38)
Location 15:26929515-26929537 15:26929544-26929566
Sequence CCCCTGCCCCTGTAGCAGCTTAT GCCCCACAGCTCTCTGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 186} {0: 1, 1: 0, 2: 2, 3: 37, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!