ID: 1124129390_1124129406

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124129390 1124129406
Species Human (GRCh38) Human (GRCh38)
Location 15:26971210-26971232 15:26971245-26971267
Sequence CCCGCGCCCGCTCGCGGCTCCAG GCGCCGCGCCAGGGGGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 225} {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!