ID: 1124136166_1124136177

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1124136166 1124136177
Species Human (GRCh38) Human (GRCh38)
Location 15:27038085-27038107 15:27038130-27038152
Sequence CCGTAACTAGTCCCAGAACAGCC TGTAACAAATACCTTAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123} {0: 1, 1: 5, 2: 50, 3: 227, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!