|
Left Crispr |
Right Crispr |
| Crispr ID |
1124147683 |
1124147688 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:27143328-27143350
|
15:27143359-27143381
|
| Sequence |
CCTTAGCCTCTCTAAGCACTGGG |
TGTGAGCTACCATATCTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 246, 3: 3277, 4: 25497} |
{0: 2, 1: 2, 2: 40, 3: 410, 4: 1355} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|