ID: 1124156714_1124156718

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124156714 1124156718
Species Human (GRCh38) Human (GRCh38)
Location 15:27232623-27232645 15:27232645-27232667
Sequence CCTACAATTCTGCTTTTAATCAT TTCAGTCTTGACTTGGGGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 463} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!