ID: 1124157857_1124157860

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1124157857 1124157860
Species Human (GRCh38) Human (GRCh38)
Location 15:27243698-27243720 15:27243746-27243768
Sequence CCATTGTCTATTTGCATATTCAT TTAATACTAATAAGGTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 77, 4: 584} {0: 1, 1: 0, 2: 1, 3: 20, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!