ID: 1124160339_1124160345

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1124160339 1124160345
Species Human (GRCh38) Human (GRCh38)
Location 15:27262519-27262541 15:27262570-27262592
Sequence CCTACCCCATCTGAGTATTGAGG TCATTCTTACTCATTTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144} {0: 1, 1: 0, 2: 5, 3: 18, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!