ID: 1124160344_1124160345

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124160344 1124160345
Species Human (GRCh38) Human (GRCh38)
Location 15:27262556-27262578 15:27262570-27262592
Sequence CCGTCACATGTTTGTCATTCTTA TCATTCTTACTCATTTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 310} {0: 1, 1: 0, 2: 5, 3: 18, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!