ID: 1124162256_1124162262

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1124162256 1124162262
Species Human (GRCh38) Human (GRCh38)
Location 15:27283170-27283192 15:27283191-27283213
Sequence CCAAGATTCCCACTTGGTCTCTG TGCCAGCACCATGAAGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 223} {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!