ID: 1124164972_1124164977

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124164972 1124164977
Species Human (GRCh38) Human (GRCh38)
Location 15:27318384-27318406 15:27318398-27318420
Sequence CCCCTCAGATGGGACTTGCACCC CTTGCACCCTGCCAGGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101} {0: 1, 1: 0, 2: 2, 3: 24, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!