ID: 1124178865_1124178869

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124178865 1124178869
Species Human (GRCh38) Human (GRCh38)
Location 15:27454339-27454361 15:27454353-27454375
Sequence CCACGCCTTATCTAAGCATTTAC AGCATTTACAAGGCTGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121} {0: 1, 1: 0, 2: 4, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!