ID: 1124208088_1124208094

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1124208088 1124208094
Species Human (GRCh38) Human (GRCh38)
Location 15:27740359-27740381 15:27740374-27740396
Sequence CCGTCCTCCCAATTCAGACACAA AGACACAACCCGGGAGCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!