ID: 1124219360_1124219373

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1124219360 1124219373
Species Human (GRCh38) Human (GRCh38)
Location 15:27835831-27835853 15:27835883-27835905
Sequence CCCCTAGTGGTCTGCGTGCCTCT CCTGAAAAGTATACAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 335, 4: 6053} {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!